View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_348 (Length: 217)
Name: NF8521A_low_348
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_348 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 39495611 - 39495413
Alignment:
| Q |
1 |
agagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgatttgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495611 |
agagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgatttgtga |
39495512 |
T |
|
| Q |
101 |
atacaggcattgtgtagagtatatt--ggtaagctattatgcagtgttaatagtattagtaactgacaattacataagttgttatgttagtcatcgtat |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39495511 |
atacaggcattgtgtagagtatattggggtaagctattatgcagtgtgaatagtattagtaactgataattacataagttgttatgttagtcatcgtat |
39495413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University