View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_349 (Length: 217)
Name: NF8521A_low_349
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_349 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
| [»] scaffold0177 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 21 - 198
Target Start/End: Original strand, 1637 - 1814
Alignment:
| Q |
21 |
aatgtatctttaattttggttttgcttactttctagtttagattaggtggcgtgaggcttttgtaatacttcgtgtctcgacaggtttttagtaggttga |
120 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| | |||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
1637 |
aatgtatctttaattttggttttgattactttctagtttagattaggtggcgtaaggcctatgtaatacttggtgtcttgacaggtttttagtaggttga |
1736 |
T |
|
| Q |
121 |
atttggtgtaannnnnnnncctcatctagctctagtgcgtcattgagttcctcatctaactcttatggttccgttgcg |
198 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1737 |
atttggtgtaattttttttcctcatctagctctagtgcgtcattgagttcctcatctaactcttatggttccgttgcg |
1814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0177 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: scaffold0177
Description:
Target: scaffold0177; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 28 - 171
Target Start/End: Original strand, 30061 - 30204
Alignment:
| Q |
28 |
ctttaattttggttttgcttactttctagtttagattaggtggcgtgaggcttttgtaatacttcgtgtctcgacaggtttttagtaggttgaatttggt |
127 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| | ||| ||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30061 |
ctttaattttggtttttcttactttctagtttagattaggtggcttaagggtttcataatacttggtgtctcgacaggtttttagtaggttgaatttggt |
30160 |
T |
|
| Q |
128 |
gtaannnnnnnncctcatctagctctagtgcgtcattgagttcc |
171 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| |
|
|
| T |
30161 |
gtaattttttttcctcatctagctctagtgtctcattgagttcc |
30204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University