View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_354 (Length: 215)
Name: NF8521A_low_354
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_354 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 24 - 194
Target Start/End: Complemental strand, 54778535 - 54778365
Alignment:
| Q |
24 |
ggaatgtgatatctattttttaaaaattaactagcatattccatccaccctttactaccaaacaaaaatatcccatctgagttattctaaaatttaacct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54778535 |
ggaatgtgatatctattttttaaaaattaactagcatattccatccaccctttactaccaaacaaaaatatcccatctgagttattctaaaatttaacct |
54778436 |
T |
|
| Q |
124 |
ttgttccgttattattagttttttcctttcgattatatgcaactgtatattgttgattaatgttcatttct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54778435 |
ttgttccgttattattagttttttcctttcaattatatgcaactgtatattgttgattaatgttcttttct |
54778365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 24 - 194
Target Start/End: Original strand, 54790610 - 54790780
Alignment:
| Q |
24 |
ggaatgtgatatctattttttaaaaattaactagcatattccatccaccctttactaccaaacaaaaatatcccatctgagttattctaaaatttaacct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54790610 |
ggaatgtgatatctattttttaaaaattaactagcatattccatccaccctttactaccaaacaaaaatatcccatctgagttattctaaaatttaacct |
54790709 |
T |
|
| Q |
124 |
ttgttccgttattattagttttttcctttcgattatatgcaactgtatattgttgattaatgttcatttct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54790710 |
ttgttccgttattattagttttttcctttcaattatatgcaactgtatattgttgattaatgttcttttct |
54790780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 24 - 194
Target Start/End: Original strand, 52283272 - 52283438
Alignment:
| Q |
24 |
ggaatgtgatatctattttttaaaaattaactagcatattccatccaccctttactaccaaacaaaaatatcccatctgagttattctaaaatttaacct |
123 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52283272 |
ggaatgggatatctctttttttaaaattaacctgcatattcca----ccctttactaccagtcaaaaatatcccatctgagttattcgaaaatttaacct |
52283367 |
T |
|
| Q |
124 |
ttgttccgttattattagttttttcctttcgattatatgcaactgtatattgttgattaatgttcatttct |
194 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52283368 |
ttgttttgttattattagttttttcctttcaattatatgcaactgtatattgttgattaatgttcttttct |
52283438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University