View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_357 (Length: 212)
Name: NF8521A_low_357
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_357 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 12 - 178
Target Start/End: Complemental strand, 25697071 - 25696905
Alignment:
| Q |
12 |
gatggacatcaatcctagtccaaaaattgatcttgtctatcaaatatattcatatcaatgtagcagcaagactttagattgaacaccaacacacgtggtt |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25697071 |
gatgcacatcaatcctagtccaaaaattgatcttgtctatcaaatatattcatatcaatgtagcaccaagaatttagattgaacaccaacacacgtggtt |
25696972 |
T |
|
| Q |
112 |
acatccagttttcgaaaattattaccaatgtctacttattattgtcagtgtcgtgtctgatgtccat |
178 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25696971 |
acatctagttttcgaaaattattaccaatgtctacttattattgtcagtgtcgtgtctgatgtccat |
25696905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University