View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_358 (Length: 210)
Name: NF8521A_low_358
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_358 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 11051279 - 11051137
Alignment:
| Q |
20 |
atattaggttgagtcgcaaactaaatcactctcttttaaacattttgcagatttgtctcaatggtgctcggaatttcttctatttgttatacatttgaaa |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||| | ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11051279 |
atattaggttgagtcgcgaactaaatcaccat-ttttaaacattttgcggatttgtctcaatggtgctcgtaatttcttctatttgttatacatttgaaa |
11051181 |
T |
|
| Q |
120 |
attattccttttctttatgagttatactcttaaatttggtcccc |
163 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11051180 |
attattctttttctttatgagttatactcttaaatttggtcccc |
11051137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University