View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_47 (Length: 384)
Name: NF8521A_low_47
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 125 - 242
Target Start/End: Original strand, 23891906 - 23892023
Alignment:
| Q |
125 |
gttggctctagaaataccagtttaattcatttctttatttaaaggcataattttgaaaagaaaaatttgaaaaacctcctagattttttacaaaatgcat |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23891906 |
gttggctctagaaataccaggttaattcatttctttatttaaaggcatggttttgaaaagaaaaatttgaaaaacctcctagattttttacaaaatgcat |
23892005 |
T |
|
| Q |
225 |
aatggataagtaaatgta |
242 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
23892006 |
aatggataagcaaatgta |
23892023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 203 - 286
Target Start/End: Original strand, 1098885 - 1098969
Alignment:
| Q |
203 |
ctagattttttacaaaatgcataatggataagtaaatgtata-catgcatgtgcctattggccatttgacactattagattatca |
286 |
Q |
| |
|
|||||||||| |||||| |||| |||||| |||||| | | | ||||||||||| | || ||||||||||||||| ||||||||| |
|
|
| T |
1098885 |
ctagatttttcacaaaaagcattatggatgagtaaaaggagagcatgcatgtgcttcttagccatttgacactatcagattatca |
1098969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University