View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_54 (Length: 375)
Name: NF8521A_low_54
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_54 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 88 - 375
Target Start/End: Original strand, 5012040 - 5012327
Alignment:
| Q |
88 |
ggacaaccacgaaagagagggaggcctgctaagctatcaccgatcaatgcattatgggtgtctcaaccgctagctcacggcaaaaaacctgcaccgatta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012040 |
ggacaaccacgaaagagagggaggcctgctaagctatcaccgatcaattcattatgggtgtctcaaccgctagctcacggcaaaaaacctgcaccgatta |
5012139 |
T |
|
| Q |
188 |
agcctcagtttgagagtaaatcacccatctttgaaaaagttatcctcaaaaaggtagatcacaaagaaataccagttcgttatgttagatatattgggaa |
287 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5012140 |
agactcagtttgagagtaaatcacccatctttgaaaaagttatcctcaaaaaggtagatcacaaagaaataccagttcgttatgctagatatattgggaa |
5012239 |
T |
|
| Q |
288 |
tactgctggaacaccttctcaataccccgcgaggcatgtgttagatgcaacacatcaacaaggagggaacgtaactcctggaagtaat |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012240 |
tactgctggaacaccttctcaataccccgcgaggcatgtgttagatgcaacacatcaacaaggagggaacgtaactcctggaagtaat |
5012327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 12 - 57
Target Start/End: Original strand, 5011994 - 5012039
Alignment:
| Q |
12 |
tatacttgaacaagaagtttcgtcactcaaaaaagataaaatggaa |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5011994 |
tatacttgaacaagaagtttcgtcactcaaaaaagataaaatggaa |
5012039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University