View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_56 (Length: 373)
Name: NF8521A_low_56
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 28 - 359
Target Start/End: Original strand, 7752752 - 7753083
Alignment:
| Q |
28 |
cacctcgactttagcttggacagtctcaccggcccaatccctgatttcttaggtcaactcaagaacctcgatgtcatcgacctctccgggaacaggttta |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7752752 |
cacctcgactttagcttggacagtctcacaggcccaatccctgatttcttaggtcaactcaagaacctcgatgtcatcgacctctctgggaacaggttta |
7752851 |
T |
 |
| Q |
128 |
ccggccaaatccctgcatcactaggtcgactcactaagcttagaagcgctaaccttggctcaaaccaactctccggcccaatcccagcctccttaggcat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752852 |
ccggccaaatccctgcatcactaggtcgactcaccaagcttagaagcgctaaccttggctcaaaccaactctccggcccaatcccagcctccttaggcat |
7752951 |
T |
 |
| Q |
228 |
gatcaagagcctagaacaactctacatatacattaacaacttatctggcccaattccagcttctttagctcaacttcctaaactcaacgaactttcccta |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752952 |
gatcaagagcctagaacaactctacatatacattaacaacttatctggcccaattccagcttctttagctcaacttcctaaactcaacgaactttcccta |
7753051 |
T |
 |
| Q |
328 |
tttcaaaaccagctaaccggctcaatccctga |
359 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
7753052 |
tttcaaaaccagttaaccggctcaatccctga |
7753083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University