View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_57 (Length: 372)
Name: NF8521A_low_57
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 102 - 246
Target Start/End: Complemental strand, 14878939 - 14878795
Alignment:
| Q |
102 |
gaagaatattggtgaaatgaagagaatgttttgagcttgaatagcttaattcttttcttgcaagtaattctcttaatgtttaaagttgagtacgtgtgta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14878939 |
gaagaatattggtgaaatgaagagaatgttttgagcttgaatagcttaattcttttcttgcaaataattctcttaatgtttaaagttgagtacgtgtgta |
14878840 |
T |
|
| Q |
202 |
tttgtatgagcctttaggctttaaaattgtagagcactaagctat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14878839 |
tttgtatgagcctttaggctttaaaattgtagagcagtaagctat |
14878795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University