View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_63 (Length: 364)
Name: NF8521A_low_63
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 23 - 358
Target Start/End: Original strand, 38831072 - 38831396
Alignment:
| Q |
23 |
ttaagtaaaagggtttgtaactaattaacaaacatataccaaattaaatagcaattatatatatagtaactcaccttaacttttctcttcccatgaggat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
38831072 |
ttaagtaaaagggtttgtaactaattaacaaacatataccaaattaaatagcaattat-----------ctcaccttcacttttctcttcccatgaggat |
38831160 |
T |
 |
| Q |
123 |
tattctttgattgagatgatgattttcttcctttctcaccttccttaggcaatggattcggcacaacggattcatctcttttgctaattatctcttccac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831161 |
tattctttgattgagatgatgattttcttcctttctcaccttccttaggcaatggattcggcacaacggattcatctcttttgctaattatctcttccac |
38831260 |
T |
 |
| Q |
223 |
acgactcgaacttgaatctgaagaataaactactttctcttcatcttgtaattttctctcaatactaaccatattcccatcattacaagatttgctattt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831261 |
acgactcgaacttgaatctgaagaataaactactttctcttcatcttgtaattttctctcaatactaaccatattcccatcattacaagatttgctattt |
38831360 |
T |
 |
| Q |
323 |
gcacccgacgaatttatatccgattcctcaccgctg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831361 |
gcacccgacgaatttatatccgattcctcaccgctg |
38831396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University