View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_80 (Length: 346)
Name: NF8521A_low_80
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_80 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 22 - 346
Target Start/End: Complemental strand, 1330086 - 1329762
Alignment:
| Q |
22 |
caatgctagcattgctggccttccggctgaaccaagtgctacactgctagcacttccactgcaaccatatcccactccttgcatggctgcattcatttct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330086 |
caatgctagcattgctggccttccggctgaaccaagtgctacactgctagcacttccactgccaccatatcccactccttgcatggctgcattcatttct |
1329987 |
T |
|
| Q |
122 |
ccttgtttatacataccatccaacaataatgtatcaaagcctccacctaatgcaggctgctggtttcctaagtggctggttgattgtaccaacgctgttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329986 |
ccttgtttatacataccatccaacaataatgtatcaaagcctccacctaatgcaggctgctggtttcctaagtggctggttgattgtaccaacgctgttt |
1329887 |
T |
|
| Q |
222 |
cccaatctgcactctcgtcaaatgcatgccatggaagtgcttttattccaccttcacttgttgctggtgcagccccatcaaataaagctaaggcaagttt |
321 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1329886 |
cccaatctgcactctcatcaaatgcatgccatggaagtgcttttattccaccttcacttgttgctggtgcagccccatcaaataaagctaaggctagttt |
1329787 |
T |
|
| Q |
322 |
gtccccatgttcttcagttgtcact |
346 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1329786 |
gtccccatgttcttcagttgtcact |
1329762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University