View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_86 (Length: 333)
Name: NF8521A_low_86
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_86 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 133 - 333
Target Start/End: Original strand, 32184385 - 32184585
Alignment:
| Q |
133 |
aggtcaaagattctattccaaatcatttaaattcacgacattggaagaagacgaatggtcactgcaatatgcaagctcagacattcccaaaaggctcgta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32184385 |
aggtcaaagattctattccaaatcatttaaattcaccacattggaagaagacgaatggtcaccgcaaaatgcaagctcagacattcccaaaaggctcgta |
32184484 |
T |
|
| Q |
233 |
aatctacttctaaaatgactactcccaaattaaccatgaccaaacaacgaagtgactacgggtttatgcattatgcaacactaacgcacaggacatgaag |
332 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32184485 |
aatctgcttctaaaatgattactcccaaattaaccatgaccaaacaatgaagtgactacgggtttatgcattatgcaacactgacgcacatgacatgaag |
32184584 |
T |
|
| Q |
333 |
g |
333 |
Q |
| |
|
| |
|
|
| T |
32184585 |
g |
32184585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 5 - 85
Target Start/End: Original strand, 32184257 - 32184337
Alignment:
| Q |
5 |
cagatctgtgcatgaaagatgactacactctattattttcgtggcaatatgtctctttggacttgaggttgaggcagttag |
85 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32184257 |
cagatccgtgcatgaaagatgactactctctattattttcctggcaatatgtctctttggacttgaggttgaggcagttag |
32184337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University