View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_90 (Length: 330)
Name: NF8521A_low_90
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_90 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 19 - 330
Target Start/End: Original strand, 36170376 - 36170687
Alignment:
| Q |
19 |
gttggtgttgaggaagttaagagatttatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170376 |
gttggtgttgaggaagttaagagattcatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt |
36170475 |
T |
|
| Q |
119 |
caatagggttcattcagaatattgcctttggagatgagttggttaggcaaacggtgattagagaaggcggaatccgtgctttgttacgtgttttagatcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170476 |
caatagggttcattcagaatattgcctttggagatgagttggttaggcaaatggtgattagagaaggcggaatccgtgctttgttacgtgttttagatcc |
36170575 |
T |
|
| Q |
219 |
gaaatggtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170576 |
gaaatggtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttat |
36170675 |
T |
|
| Q |
319 |
ggttttgtggat |
330 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36170676 |
ggttttgtggat |
36170687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 291 - 330
Target Start/End: Complemental strand, 1286394 - 1286355
Alignment:
| Q |
291 |
tagctctgtaagtattttaatgagttatggttttgtggat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286394 |
tagctctgtaagtattttaatgagttatggttttgtggat |
1286355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University