View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521A_low_97 (Length: 325)
Name: NF8521A_low_97
Description: NF8521A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521A_low_97 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 91 - 184
Target Start/End: Original strand, 3968014 - 3968107
Alignment:
| Q |
91 |
tctcatagcaagtttttggtggtatctttcatatccatggctgaagttctgaattatactctcattttcacactagggaccacgtttccattct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3968014 |
tctcatagcaagtttttggtggtatctttcatatccatggctgaagttctgaattatactctcattttcacactagggaccacgtttccattct |
3968107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University