View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521_high_28 (Length: 223)
Name: NF8521_high_28
Description: NF8521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 215
Target Start/End: Original strand, 43229625 - 43229833
Alignment:
| Q |
7 |
gagatggacatcaaaactatgtacaaaatatgttgcaaatcttttctatcaaacataaaccagtaaccatggtttaaatcagattatccatagaaaggat |
106 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43229625 |
gagaaggacgtcaaaactatgtacaaaatatgttgcaaatcttttctatcaaacataaaccagtaaccatggtttaaatcagattatccatagaaaggat |
43229724 |
T |
|
| Q |
107 |
gagggggaaaagaaaaagttaaggcatgaactcggatcaaaatcagaggtatggtaagcattatcaatatgtttggctgtaccaaaaatgactctgtatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
43229725 |
gagggggaaaagaaaaagttaaggcatgaactcggatcaaaatcagaggtatggtaagcattatcaatctgtttggctgtaccaaaaatgactgtgtatt |
43229824 |
T |
|
| Q |
207 |
tagtataat |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
43229825 |
tagtataat |
43229833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University