View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8521_low_40 (Length: 240)

Name: NF8521_low_40
Description: NF8521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8521_low_40
NF8521_low_40
[»] chr3 (1 HSPs)
chr3 (17-240)||(42888125-42888348)


Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 42888125 - 42888348
Alignment:
17 agtttgcatgataaaatgtgcatatgatttgccagaaagnnnnnnnntccttttcctttttatagtatcaatatatatactgatttttccactgacggtt 116  Q
    |||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||    
42888125 agtttgcatgataaaatgtgcatatgatttgccagaaagaaaaaaaatccttttcctttttatagtatcaatatatatactgatttttccactgacggtt 42888224  T
117 taaccgtacggactgcattttagtatgtgaacgtgtgatattgtcatcaaaatataggttactgctattatagagaaagattcaccatagaatctaaatc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42888225 taaccgtacggactgcattttagtatgtgaacgtgtgatattgtcatcaaaatataggttactgctattatagagaaagattcaccatagaatctaaatc 42888324  T
217 atatccgtgtcaaagtggtttttc 240  Q
    ||||||||||||||||||||||||    
42888325 atatccgtgtcaaagtggtttttc 42888348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University