View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521_low_42 (Length: 240)
Name: NF8521_low_42
Description: NF8521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 44965297 - 44965519
Alignment:
| Q |
1 |
ccagtccgcttgatctcgacccaatgaccaccaatgtacggattgtgtgaatgtgtggattgttgattgcaacaaattaaaatccattaaaatcatgatt |
100 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44965297 |
ccagtccgcttgatttcgatccaatgaccaccaatgtacggattgtgtgaatgtgtggattgttgattgcaacaaattaaaatccgttaaaatcatgatt |
44965396 |
T |
|
| Q |
101 |
ttaatatgttacttttctatataaaggtggtggtccaaggaaactattgccgtggttaccggtggaaaccgaggaattggttttgagatttcaagacaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965397 |
ttaatatgttacttttctatataaaggtggtggtccaaggaaactattgccgtggttaccggtggaaaccgaggaattggttttgagatttcaagacaac |
44965496 |
T |
|
| Q |
201 |
ttgcagatcatggagttactgtt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44965497 |
ttgcagatcatggagttactgtt |
44965519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 118 - 222
Target Start/End: Original strand, 40068703 - 40068807
Alignment:
| Q |
118 |
tatataaaggtggtggtccaaggaaactattgccgtggttaccggtggaaaccgaggaattggttttgagatttcaagacaacttgcagatcatggagtt |
217 |
Q |
| |
|
|||||| ||||||||||| |||||||| ||||| |||||||| |||||||| |||||||||| ||||| ||||||||||||||||| || |||||||| |
|
|
| T |
40068703 |
tatatataggtggtggtctaaggaaacaattgctgtggttactggtggaaatagaggaattgggtttgaaatttcaagacaacttgctgaacatggagta |
40068802 |
T |
|
| Q |
218 |
actgt |
222 |
Q |
| |
|
||||| |
|
|
| T |
40068803 |
actgt |
40068807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 125 - 223
Target Start/End: Original strand, 10898328 - 10898426
Alignment:
| Q |
125 |
aggtggtggtccaaggaaactattgccgtggttaccggtggaaaccgaggaattggttttgagatttcaagacaacttgcagatcatggagttactgtt |
223 |
Q |
| |
|
||||||||||| || ||||||||||| |||||||||||||||||| |||||||||| |||||||||| || |||||||| | ||||||| | |||||| |
|
|
| T |
10898328 |
aggtggtggtctaaagaaactattgctgtggttaccggtggaaacagaggaattgggtttgagatttgcaggcaacttgctgctcatggattgactgtt |
10898426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University