View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521_low_43 (Length: 239)
Name: NF8521_low_43
Description: NF8521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521_low_43 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 147 - 224
Target Start/End: Complemental strand, 15030271 - 15030194
Alignment:
| Q |
147 |
cagatttaaaagagtaaaaagtaaaggcaatatgtcttttaacatagtaacattaaaaaggctctaaaaatacttttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15030271 |
cagatttaaaagagtaaaaagtaaaggcaatatgtcttttaacatagtaacattaaaaaggctttaaaaatacttttt |
15030194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 138859 - 138988
Alignment:
| Q |
1 |
cctgaaaaggtgagatggaccataactaaactatgttttttcttcaaggctatatgtagcaaagtcatcaatcctgagaagttgtgagcattgcagaatg |
100 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||| |||||||| ||||| | ||||||||| || | |||||||||||| || | || |||| |
|
|
| T |
138859 |
cctgaaaatgtgcgatggaccataactaaactttgtttcttcttcaaagctatttctagcaaagttattgaccctgagaagttgccgacactacaaaatg |
138958 |
T |
|
| Q |
101 |
aaattgttgtcaccttatgtgagcttgaga |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
138959 |
aaattgttgtcaccttatgtgagcttgaga |
138988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 20749986 - 20750115
Alignment:
| Q |
1 |
cctgaaaaggtgagatggaccataactaaactatgttttttcttcaaggctatatgtagcaaagtcatcaatcctgagaagttgtgagcattgcagaatg |
100 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||| |||||||| ||||| | ||||||||| || | |||||||||||| || | || |||| |
|
|
| T |
20749986 |
cctgaaaatgtgcgatggaccataactaaactttgtttcttcttcaaagctatttctagcaaagttattgaccctgagaagttgccgacactacaaaatg |
20750085 |
T |
|
| Q |
101 |
aaattgttgtcaccttatgtgagcttgaga |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20750086 |
aaattgttgtcaccttatgtgagcttgaga |
20750115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University