View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521_low_51 (Length: 223)
Name: NF8521_low_51
Description: NF8521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521_low_51 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42888613 - 42888385
Alignment:
| Q |
1 |
agacttgaaaatatctttgtctacatttgcactccaccat------ggattctgataagatggaaccccaagtcaaattatgttttcgatgactgtttta |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42888613 |
agacttgaaaatatctttgtctacatttgcactccaccatcaccatggattctgataagatggaaccccaagtcaaattatgttttcgatgactgttttt |
42888514 |
T |
 |
| Q |
95 |
agtgtttttgacttattttagctgagttgatcgtagcgatggtctcatatttacattcaatattttacgtacgaatacacacataatatacaaaattata |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42888513 |
agtgtttttgacttattttagctgagttgatcgtagcgatggtctcatatttacattcaatattttacgtacgaatacacacataatatacaaaattata |
42888414 |
T |
 |
| Q |
195 |
tactagaggtaggacttaatcgatccttt |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
42888413 |
tactagaggtaggaattaatcgatccttt |
42888385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University