View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8521_low_53 (Length: 213)
Name: NF8521_low_53
Description: NF8521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8521_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 12 - 194
Target Start/End: Original strand, 28668503 - 28668685
Alignment:
| Q |
12 |
aagcagagaacaataacaataacaaaagggaaaaggtttaaagaccaaccaaccttaaagaaccagtaactgagaagcaacccagtttggcttaatcttc |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28668503 |
aagcaaagaacaataacaataacaaaagggaaaaggtttaaagaccaaccaaccttaaagaaccagtaactgagaagcaacccagtttggcttaatcttc |
28668602 |
T |
 |
| Q |
112 |
aaacttcatagttctctttctctctctaataatacaatatacaagtagtggaatgcttctagaataatgaatgaagacaacac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28668603 |
aaacttcatagttctctttctctctctaataatacaatatacaagtagtggaatgcttctagaataatgaatgaagacaacac |
28668685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University