View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8522_high_8 (Length: 361)
Name: NF8522_high_8
Description: NF8522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8522_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 19 - 345
Target Start/End: Original strand, 4179281 - 4179607
Alignment:
| Q |
19 |
gattggtccttaactggttggattgtggaatcacttgctagggccttattggatcatcctctactagctggtcgagtccaaaaaagggacataacaggat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4179281 |
gattggtccttaactggttggattgtggaatcacttgctagggccttattggatcatcctctactggctggtcgagtccaaaaaagggacataacaggat |
4179380 |
T |
 |
| Q |
119 |
tggaaattgtgtctaatgattctggaattcgactattagaggctcattaccctacaagcttatctgagttccttgagtcgaataaaaatgaacacgatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4179381 |
tggaaattgtgtctaatgattctggaattcgactcttagaggctcattaccctacaagcttatctgagttccttgagtcgaataaaaatgaacacgatga |
4179480 |
T |
 |
| Q |
219 |
tgatcatgaggctcaccttgttttctggaatgaaattgatggccaatttcctctgttctctcccctcttttatgttcaggcaaatatattcacatattta |
318 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4179481 |
tgatcatgaggctcgccttgttttctggaatgaaattgatggccaatttcctctgttctctcccctcttttatgttcaggcaaatatattcacatattta |
4179580 |
T |
 |
| Q |
319 |
ttttatttaatttttggtaaatgatgt |
345 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4179581 |
ttttatttaatttttggtaaatgatgt |
4179607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University