View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8522_low_16 (Length: 358)
Name: NF8522_low_16
Description: NF8522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8522_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 14 - 342
Target Start/End: Complemental strand, 38919076 - 38918745
Alignment:
| Q |
14 |
gttcattcgtcctgcaagagggtagaaatgagttaagatttttgatagggattttttgagagtgttggatatggtggttgtgttgagtgcgtcgttgtga |
113 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38919076 |
gttcattcttcccgcaagagggtagaaatgagttaagatttttgatagggattttttgagagtgttggatatggtggctgtgttgagtgcgtcgttgtga |
38918977 |
T |
 |
| Q |
114 |
gagtagaagaggacgatagggttataaaccataggtgcgatttggtcgagaaaggagagttggtaatggcgaagatgggatggagttggagaagaaggtt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918976 |
gagtagaagaggacgatagggttataaaccataggcgcgatttggtcgagaaaggagagttggtaatggcgaagatgggatggagttggagaagaaggtt |
38918877 |
T |
 |
| Q |
214 |
tgatgatttctttggagattatttcaacttctaacttcattcttaaa---tatatcttattgatgtttatggaacagcttcaatgtttattgtgttgtgt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918876 |
tgatgatttctttggagattatttcaacttctaacttcattcttaaatagtatatcttattgatgtttatggaacagcttcaatgtttattgtgttgtgt |
38918777 |
T |
 |
| Q |
311 |
tatcgtctcgtcttttgtctctctatcatgtt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38918776 |
tatcgtctcgtcttttgtctctctatcatgtt |
38918745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University