View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8522_low_17 (Length: 321)
Name: NF8522_low_17
Description: NF8522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8522_low_17 |
 | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0008 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 17 - 318
Target Start/End: Original strand, 60817 - 61118
Alignment:
| Q |
17 |
cagaccggaccaaaatttaaaacaatggatgagattatagcaaaaacaaaatctagacatgcattgcatgcatgaattaagcgtggatgatttttaaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
60817 |
cagaccggaccaaaatttaaaacagtggatgacattatagcaaaaacaaaatctagacatgcattgcatgcatgaattaagcgtggatgatttttaaaaa |
60916 |
T |
|
| Q |
117 |
tagagttccaattaaggataactttttgataagaggagttggttttatctctttgttatattgtgtaggtgggtgtggtgtcccgaaaagtgtaaatcat |
216 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
60917 |
tagagttccaattgaggataacttttcgataagaggagttggttttatctcttcgttatattgtgtaggtgggtgtggtgtcccgaaaagtgtaaatcat |
61016 |
T |
|
| Q |
217 |
atcttccttaacggtgcaattttctcggggctatggtctgcgtctttgaattggataggggttttggctgccctgcaacatgggacctggaacaccaaac |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
61017 |
atcttccttaacggtgcaattttctcggggctatggtctgcgtctttgaattggataggggttttggctgccctgcagcatgggacctggagcaccaaac |
61116 |
T |
|
| Q |
317 |
tc |
318 |
Q |
| |
|
|| |
|
|
| T |
61117 |
tc |
61118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University