View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8522_low_21 (Length: 283)
Name: NF8522_low_21
Description: NF8522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8522_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 11 - 205
Target Start/End: Complemental strand, 36292231 - 36292037
Alignment:
| Q |
11 |
gtggtggtgttgagaggctgcttgaggagtctccttcaatgtcaggcaagagacagaagttgagcaggagtgtgaaagttttgaaagaaagcaaagagac |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
36292231 |
gtggtggtgttaagaggctgcttgaggagtctccttcaatatcaggcaagagacagaagttgagcaggagtgtgacagttttgagagaaagcaaagagac |
36292132 |
T |
 |
| Q |
111 |
cgtggcaaacattatggacaggattggaaattatggagataactagaagctgtgcttgatgagtgttaatggttgtagtcaattctggaattgtc |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
36292131 |
cgtggccaacattatggacaggattggaaattatggagataactagaagcagtgcttgatgagtgttaagggttggagtcaattctggaattgtc |
36292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 8 - 159
Target Start/End: Complemental strand, 36311650 - 36311499
Alignment:
| Q |
8 |
ttggtggtggtgttgagaggctgcttgaggagtctccttcaatgtcaggcaagagacagaagttgagcaggagtgtgaaagttttgaaagaaagcaaaga |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| || || || || |||||||| | || ||||| |||||||||||| | | ||||||||| || |
|
|
| T |
36311650 |
ttggtggcagtgttgagaggctgcttgaggaatctccatctatttctggtaagagacaaagattaagcagcagtgtgaaagttcttagagaaagcaagga |
36311551 |
T |
 |
| Q |
108 |
gaccgtggcaaacattatggacaggattggaaattatggagataactagaag |
159 |
Q |
| |
|
||| ||||| || |||||||||||||||||| ||||| | |||||||||| |
|
|
| T |
36311550 |
gactgtggccaatattatggacaggattggagtctatggcgttaactagaag |
36311499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University