View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8522_low_31 (Length: 235)
Name: NF8522_low_31
Description: NF8522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8522_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 3864941 - 3865143
Alignment:
| Q |
17 |
acatcaaaatataatttcttatgacaacatggtaaaaaagatcgcactattgttttgccagtggaaaattttaagtagaagaataaaatggacaagagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3864941 |
acatcaaaatataatttcttatgacaacatggtaaaaaagatcgcactattgttttgccagtggaaaagtttaagtagaagaataaaatggacaagagaa |
3865040 |
T |
|
| Q |
117 |
cacaaaaatttaatggatactataagacaatgtattatatagtgtgatttcttggtgcagctggtgactgtggactgaacatatttatttcataacttgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3865041 |
cacaaaaatttaatggatactataagacaatgtattatatagtgtgatttcttggtgcagctggtgactgtggactgaacatatttatttcataacttgg |
3865140 |
T |
|
| Q |
217 |
tta |
219 |
Q |
| |
|
||| |
|
|
| T |
3865141 |
tta |
3865143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University