View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8522_low_33 (Length: 228)
Name: NF8522_low_33
Description: NF8522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8522_low_33 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 33840310 - 33840526
Alignment:
| Q |
12 |
gatgaatcgtcgtt-ttattaatatatctcattttgattacctaaagaaaacgtattcataannnnnnngtgatattaaaatgaatcatgtctctctttt |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| | | |||||||||| ||||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
33840310 |
gatgaatcgtcgttattattaatatatctcattttgtcttcttaaagaaaacatattcataattttttgg-gatattaaaatgaatcacgtctctctttt |
33840408 |
T |
 |
| Q |
111 |
actactccgtacttctccatcatgcggacgatcataatgtcaactgaaatgggcctctcacacccatagcataaaaaatgtgtgtcactcatccatctta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33840409 |
actactccgtacttctccatcatgcggacaatcataatgtcaactgaaatgggcctctcacacgcatagcataaaaaatgtgtgtcactcatccatctta |
33840508 |
T |
 |
| Q |
211 |
tctttcaaacgtgtcgtt |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33840509 |
tctttcaaacgtgtcgtt |
33840526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University