View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8522_low_34 (Length: 222)
Name: NF8522_low_34
Description: NF8522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8522_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 280153 - 280358
Alignment:
| Q |
1 |
ttcatgaacttccaatggacaaatgttaattggaaagttagtcagaaaaatcaaacttaggtatgatttaggggatacatagagattgtaatttcagtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
280153 |
ttcatgaacttccaatggacaaatgttaattggaaagttagtcagaaaaatcaaacttaggtatgatttaagggatacatagagattgtaatttcagtta |
280252 |
T |
|
| Q |
101 |
atgaagtggacattcatttatgtcatgttta-tgatttcttagatatgattgttgttcttgattaatcggtggtataatttacaagtttggaacctatat |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
280253 |
atgaagtggacatccatttatgtcatgtttagtgatttcttagatatgattgttgttcttgattaatcggtggtataatttacaagtttggaacctatat |
280352 |
T |
|
| Q |
200 |
gacaat |
205 |
Q |
| |
|
|||||| |
|
|
| T |
280353 |
gacaat |
280358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 61 - 188
Target Start/End: Original strand, 265796 - 265924
Alignment:
| Q |
61 |
gtatgatttaggggatacatagagattgtaatttcagttaatgaagtggacattcatttatgtcatgttta-tgatttcttagatatgattgttgttctt |
159 |
Q |
| |
|
|||| |||| |||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
265796 |
gtataatttggggggtacagagagattgtaatttcagttaatgaagtgaacattcatttatgtcatgtttagtgttttcttagacatgattgttgttctt |
265895 |
T |
|
| Q |
160 |
gattaatcggtggtataatttacaagttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
265896 |
gattaatcggtggtataatttacaagttt |
265924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University