View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8522_low_9 (Length: 435)
Name: NF8522_low_9
Description: NF8522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8522_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 4e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 294 - 419
Target Start/End: Original strand, 11404535 - 11404656
Alignment:
| Q |
294 |
tgtaatcaaacaactccaaatatctctttttcatttagcatcattcttttaagaaggtaaaagaaaatatttaatcactacaaactgataatcctaacta |
393 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
11404535 |
tgtaatcaaacagccccaaatatctctttttcatttagcatcattcttttaagaaggtaaaataaaatatttaa----tacaaactgataatcctaacta |
11404630 |
T |
|
| Q |
394 |
acacaagaaatgtaatgatagaattc |
419 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
11404631 |
acacaaaaaatgtaatgatagaattc |
11404656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 11404241 - 11404312
Alignment:
| Q |
1 |
cctttcaagtttttcctctagtttttaactaacaccaaccccgaatttttcattaaaagtgacaaattaagg |
72 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11404241 |
cctttcaagttttttatctagtatttaactaacaccaaccccgaatttttcattaaaagtgacaaattaagg |
11404312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University