View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8523_low_14 (Length: 255)
Name: NF8523_low_14
Description: NF8523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8523_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 24884459 - 24884232
Alignment:
| Q |
17 |
aagaccctcgcctctaaggcattcgaacacctgacaagcttgaatgtatcattgaaattaggctcgaaaagaggaaagcccttagaattttatagaattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
24884459 |
aagaccctcgcctctaaggcattcgaacacctgacaagcttgaatgtatcattgaaactaggctcggaaagaggaaaacccttagaagtttatagaattt |
24884360 |
T |
|
| Q |
117 |
attgcctactacctactacggtgtaatggatcaggatgcaatcataagcctagaaactaatgtagttctcggtctccttcgctgacaacttctcataggc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884359 |
attgcctactacctactacggtgtaatggatcaggatacaatcataagcctagaaactaaagtagttctcggtctccttcgctgacaacttctcataggt |
24884260 |
T |
|
| Q |
217 |
agatatacacaaaactctctcatttgatg |
245 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
24884259 |
agatatacac-aaactctctcatttgatg |
24884232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 26 - 60
Target Start/End: Complemental strand, 18713463 - 18713429
Alignment:
| Q |
26 |
gcctctaaggcattcgaacacctgacaagcttgaa |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
18713463 |
gcctctaaggcattcgaacacctgacaagcttgaa |
18713429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University