View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8523_low_16 (Length: 245)
Name: NF8523_low_16
Description: NF8523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8523_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 34275654 - 34275881
Alignment:
| Q |
1 |
agaaaatcgaggacacaactgatgtagcaacatatacaaaacaccatcctcttttctcatatcttggtaaaaaccnnnnnnngcattcatttatctttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34275654 |
agaaaatcgaggacacaactgatgtagcaacatatacaaaacaccatcctcttttctcatatcttggtaaaaacctttttttgcattcatttatctttat |
34275753 |
T |
 |
| Q |
101 |
agcagcttatttgcatatcatttccttattgtttaccaatgcttgtccctactttagagaataagaaatctgatgctgatggctcttcggatgaagaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275754 |
agcagcttatttgcatatcatttccttattgtttaccaatgcttgtccctactttagagaataagaaatctgatgctgatggctcttcggatgaagaatc |
34275853 |
T |
 |
| Q |
201 |
tgacaattcaggttagaaattatgttga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34275854 |
tgacaattcaggttagaaattatgttga |
34275881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 34283050 - 34283116
Alignment:
| Q |
150 |
tactttagagaataagaaatctgatgctgatggctcttcggatgaagaatctgacaattcaggttag |
216 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |||||| || | ||||||| | |||||| |
|
|
| T |
34283050 |
tactgtagagaataagaagtctgatgctgatggctctttggatgatgattttgacaatccgggttag |
34283116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University