View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8523_low_17 (Length: 244)
Name: NF8523_low_17
Description: NF8523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8523_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 31701619 - 31701378
Alignment:
| Q |
1 |
taacatcgttaatcaactacagtaatatgtatcaacagccttaacagtagtgtgataatccagtacaagaaacaggtgcaacatggaagccacaaagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31701619 |
taacatcgttaatcaactacagtaatatgtatcaacagccttaacagtagtgtgataatccagtacgagaaacaggtgcaacatggaagccacaaagatt |
31701520 |
T |
|
| Q |
101 |
tattaccagataagaacttgttttcgtataccactaaccccccatcagaaaacaaccagtacgtaccaatgagtacaaggacttcaactatcagcagctc |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31701519 |
tattaacagataagaacttgttttcgtataccactaaccccccatcagaaaacaactagtacgtaccaataagtacaaggacttcaactatcagcagctc |
31701420 |
T |
|
| Q |
201 |
tgaaaatagtcagcaaagacaggaaaaggttgatgatgtcca |
242 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31701419 |
tgaaaatagtgagcaaagacaggaaaaggttgatgatgtcca |
31701378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University