View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8523_low_22 (Length: 211)
Name: NF8523_low_22
Description: NF8523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8523_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 25 - 195
Target Start/End: Complemental strand, 45621453 - 45621283
Alignment:
| Q |
25 |
ctttattaataggtatagattaactgcattttatctcgattacccatttactattactactagttagtcatctgtgttggttaacacctccaactggcac |
124 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45621453 |
ctttattaataggtatagattaactgcgttttatctcgattaccctgttactattactactagttagtcatctgtgttggttaacacctccaactggcac |
45621354 |
T |
|
| Q |
125 |
ccccttaaattttcttctccatgatccactggagaagcttcatgcttatcaaacaacaaggactgaatgat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45621353 |
ccccttaaattttcttctccatgatccactggagaagcttcatgcttatcaaacaacaaggactgaatgat |
45621283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 47
Target Start/End: Original strand, 29642468 - 29642497
Alignment:
| Q |
18 |
gtattgtctttattaataggtatagattaa |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29642468 |
gtattgtctttattaataggtatagattaa |
29642497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 45
Target Start/End: Complemental strand, 581769 - 581741
Alignment:
| Q |
17 |
agtattgtctttattaataggtatagatt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
581769 |
agtattgtctttattaataggtatagatt |
581741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 45
Target Start/End: Complemental strand, 23217957 - 23217929
Alignment:
| Q |
17 |
agtattgtctttattaataggtatagatt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23217957 |
agtattgtctttattaataggtatagatt |
23217929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University