View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8524_high_12 (Length: 275)
Name: NF8524_high_12
Description: NF8524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8524_high_12 |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 261
Target Start/End: Original strand, 52433585 - 52433829
Alignment:
| Q |
17 |
attaaaaataaaaggggttggactttgtactagctgaagccagaaaatatgggataaaggtaattttgagtttggtgaacaactatgaggattttggagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52433585 |
attaaaaataaaaggggttggactttgtactagctgaagccagaaaatatgggataaaggtaattttgagtttggtgaacaactatgaggattttggagg |
52433684 |
T |
 |
| Q |
117 |
gaagaaacaatatgtggagtgggcaaggagtcaaggccaatccataaactctgaagatgatttcttcactaatcctgttgtgaagggatactataaaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52433685 |
gaagaaacaatatgtggagtgggcaaggagtcaaggccaatccataaactctgaagatgatttcttcactaatcctgttgtgaagggatactataaaaat |
52433784 |
T |
 |
| Q |
217 |
cacattaaggtaaattttattttctttttcctattgccagtatta |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52433785 |
cacattaaggtaaattttattttctttttcctattgccattatta |
52433829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 140
Target Start/End: Original strand, 250392 - 250450
Alignment:
| Q |
82 |
ttgagtttggtgaacaactatgaggattttggagggaagaaacaatatgtggagtgggc |
140 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| | | ||||||||||||||||| |
|
|
| T |
250392 |
ttgagtttggtgaacaattataaggattttggaggaaggcctcaatatgtggagtgggc |
250450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 140
Target Start/End: Complemental strand, 14566983 - 14566925
Alignment:
| Q |
82 |
ttgagtttggtgaacaactatgaggattttggagggaagaaacaatatgtggagtgggc |
140 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| | | ||||||||||||||||| |
|
|
| T |
14566983 |
ttgagtttggtgaacaattataaggattttggaggaaggcctcaatatgtggagtgggc |
14566925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University