View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8524_low_17 (Length: 250)
Name: NF8524_low_17
Description: NF8524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8524_low_17 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 73 - 250
Target Start/End: Complemental strand, 30922846 - 30922667
Alignment:
| Q |
73 |
tgaggggttgatttggttg--aagtttttgaaaatcatagttcatggctgaatgatttatgagtgttttgtattttttcagtggctgggagataggcaca |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30922846 |
tgaggggttgatttggtttttaagtttttgaaaatcattgttcatggctgaatgatttatgagtgttttgtattttttcagtggctgggagataggcaca |
30922747 |
T |
 |
| Q |
171 |
agagggctttgcttgaagctttggagaaagtcaaagctggtaagaatttagtcaagggatcattagttgtgaagaattat |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||| |
|
|
| T |
30922746 |
agaaggctttgcttgaagctttggagaaagtcaaagctggtaagattttagtcaagggattattagttgtgtagaattat |
30922667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University