View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8524_low_22 (Length: 233)
Name: NF8524_low_22
Description: NF8524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8524_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 6088630 - 6088843
Alignment:
| Q |
1 |
gtggtaattaaaatgtaccatcactactggttaatcttaattacctcttgagagcatcttcattggtttctccatttgtcagtggctcaaagtggccatt |
100 |
Q |
| |
|
||||||||||||||||||| || ||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6088630 |
gtggtaattaaaatgtaccgtctctactaatttatcttaattacctcttgagagcttcttcattggtttctccatttgtcagtggctcaaagtgaccatt |
6088729 |
T |
 |
| Q |
101 |
ttccaaattgactctagagaccggtttctttaacaagttctcgccaatttggcacagtttcttcaagttctcctctgtagcaatgtcaactgaagaatct |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| || || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6088730 |
ttctaaattgactctagagaccggtttctttaataaattttcaccaatttggcacagtttcttcaagttctcctctgtagcaatgtcaactgaagaatcg |
6088829 |
T |
 |
| Q |
201 |
attcctgtcaatgt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6088830 |
attcctgtcaatgt |
6088843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University