View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8526_high_13 (Length: 246)
Name: NF8526_high_13
Description: NF8526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8526_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 20327044 - 20326820
Alignment:
| Q |
1 |
agggtgaaagtgatatggggaaactaggatcactaactatatataatatatccaagtttaattgttttgtcataattatcatattaaattatttattaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20327044 |
agggtgaaagtgatatggggaaactaggatcactaactatatataatatatccaagtttaattgttttgtcataattatcatattaaattatttattaaa |
20326945 |
T |
 |
| Q |
101 |
gttagtatgcagcaaacatattatctgaattgattttacggaatgctcggggtgagttgtcctaaaacatttctccgattatccgactaaaattcctatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20326944 |
gttagtatgcagcaaacatattatctgaattgattttacggaatgctcggggtgagttgttctgaaacatttctccgattatccgactaaaattcctatc |
20326845 |
T |
 |
| Q |
201 |
aatcaggctagagccaaaacttatc |
225 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
20326844 |
aatcaggctagagccgaaacttatc |
20326820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 215
Target Start/End: Original strand, 7451389 - 7451474
Alignment:
| Q |
130 |
ttgattttacggaatgctcggggtgagttgtcctaaaacatttctccgattatccgactaaaattcctatcaatcaggctagagcc |
215 |
Q |
| |
|
||||||||| |||||| ||||||||| ||| ||||||||| ||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7451389 |
ttgattttatggaatggctggggtgagtagtcttaaaacattcctctttctatccggctaaaatacctatcaatcaggctagagcc |
7451474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 78 - 171
Target Start/End: Complemental strand, 17659480 - 17659387
Alignment:
| Q |
78 |
atcatattaaattatttattaaagttagtatgcagcaaacatattatctgaattgattttacggaatgctcggggtgagttgtcctaaaacatt |
171 |
Q |
| |
|
|||||||| |||||||||| ||||||||| || | |||||| |||||| ||||||||||||||| | |||||||||| |||| ||||||| |
|
|
| T |
17659480 |
atcatattcaattatttataaaagttagtgtggaacaaacaacttatctaggttgattttacggaatccccggggtgagtagtcccgaaacatt |
17659387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University