View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8526_high_15 (Length: 244)
Name: NF8526_high_15
Description: NF8526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8526_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 44371231 - 44371462
Alignment:
| Q |
1 |
tataatgccacagactgatacagttacttggaatggtttgattgctggatatgtacagaacggatttacagacgaggctgtagctttgtttaaagcaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44371231 |
tataatgccacagactgatacagttacttggaatggtttgattgctggatatgtacagaacggatttacagacgaggctgtagctttgtttaaagcaatg |
44371330 |
T |
|
| Q |
101 |
gtgactagtggagtcaaactagattcaatcacatttgcaagtttccttccttcggttcttaaatccgggagtctaaaatattgtaaggaagttcatagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44371331 |
gtgactagtggagtcaaactagattcaatcacatttgcaagtttccttccttcggttcttaaatccgggagtctaaaatattgtaaggaagttcatagtt |
44371430 |
T |
|
| Q |
201 |
atatagtgcggcatggggtgccttttgatgtc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44371431 |
atatagtgcggcatggggtgccttttgatgtc |
44371462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University