View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8526_low_18 (Length: 245)
Name: NF8526_low_18
Description: NF8526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8526_low_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 26208737 - 26208510
Alignment:
| Q |
18 |
aacatgaccatgtccccaatgagaagtatccatatgacaaacaaccatagcttccaccatatccccattatcaccgacaagtgaaactctatatatccta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26208737 |
aacatgaccatgtccccaatgagaagtatccatatgacaaacaaccatagcttccaccatatccccattatcaccgacaagtgaaactctatatatccta |
26208638 |
T |
|
| Q |
118 |
ttctcactttcttggctatggcaatagaaaacagcataagggtaaggcatagtgtgacatgccaccatctttggagctgaaatcctcataattttttcta |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26208637 |
ttttcactttcttggctatggcaatagaatacagcataagggtaaggcatagtgtgacatgccaccatctttggagctgaaatcctcataattttttcta |
26208538 |
T |
|
| Q |
218 |
atatagtatagttctgaaaagtgacact |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26208537 |
atatagtatagttctgaaaagtgacact |
26208510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 43 - 195
Target Start/End: Complemental strand, 49755442 - 49755290
Alignment:
| Q |
43 |
gtatccatatgacaaacaaccatagcttccaccatatccccattatcaccgacaagtgaaactctatatatcctattctcactttcttggctatggcaat |
142 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| ||||| ||||| || | |||| ||||||| | |||||| ||||||||||||| ||| |||| |
|
|
| T |
49755442 |
gtatccatatgacaaaccgccatagcttccaccttatctccattctcaccaaccaatgaagctctatacaccctattatcactttcttggccatgacaat |
49755343 |
T |
|
| Q |
143 |
agaaaacagcataagggtaaggcatagtgtgacatgccaccatctttggagct |
195 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||| |||||||| || |||||| |
|
|
| T |
49755342 |
aaaaaacagcataagggtaaggcacagtgtgacaagccaccattttgggagct |
49755290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 52 - 195
Target Start/End: Original strand, 54448841 - 54448984
Alignment:
| Q |
52 |
tgacaaacaaccatagcttccaccatatccccattatcaccgacaagtgaaactctatatatcctattctcactttcttggctatggcaatagaaaacag |
151 |
Q |
| |
|
|||||||| ||||| || || ||| |||| ||||| ||||| | | | ||||| |||| | |||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
54448841 |
tgacaaaccaccatggcctcaaccttatctccattctcaccccccaataaaactttatacaccctattctcactttcttgactatgacaataaaaaacag |
54448940 |
T |
|
| Q |
152 |
cataagggtaaggcatagtgtgacatgccaccatctttggagct |
195 |
Q |
| |
|
||||||| ||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
54448941 |
cataaggataaggcacagtgtgacaagccaccatctttggagct |
54448984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University