View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8527_low_5 (Length: 377)
Name: NF8527_low_5
Description: NF8527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8527_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 44994719 - 44994412
Alignment:
| Q |
1 |
atttgatctcatttcagagagaagattctccatctcgttgaatttaccatggaagccaagtttttgaagcatggatttgtaggtgaagagagtgtgtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44994719 |
atttgatctcatttcagagagaagattctccatctcgttgaatttaccatggaagccaagtttttgaagcatggatttgtaggtgaagagagtgtgtttg |
44994620 |
T |
 |
| Q |
101 |
aatccttgttcgttttttgatgagttgaagatttctaatgcttttagtggatctttttgtactttcactacagctgcaacatgttttggaagcaacgcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44994619 |
aatccttgttcgttttttgatgagttgaagatttctaatgcttttagtggatcattttgtactttcactacagctgcaacatgttttggaagcaacgcac |
44994520 |
T |
 |
| Q |
201 |
gattcattct---aacataaataactacaacaaggtttcaggttcttgtgcgggtttttgcaatgtttnnnnnnnnnnnnnggaaattaaaccaaacgaa |
297 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44994519 |
gattcattctaagaacataaacaactacaacaaggtttcaggttcttgtgcgggtttttgcaatgtttgaaaaatgaaaaaggaaattaaaccaaacgaa |
44994420 |
T |
 |
| Q |
298 |
gcgttttg |
305 |
Q |
| |
|
|||||||| |
|
|
| T |
44994419 |
gcgttttg |
44994412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 296 - 359
Target Start/End: Complemental strand, 44992807 - 44992744
Alignment:
| Q |
296 |
aagcgttttgtttctagttgtggaatgtaattgccacgtcataaaaaagtaggacccattggag |
359 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44992807 |
aagcgttttgtttctagttgtggaatgtgattgccacgtcataaaaaagtaggacccattggag |
44992744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University