View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8527_low_9 (Length: 342)
Name: NF8527_low_9
Description: NF8527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8527_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 10 - 328
Target Start/End: Complemental strand, 14532413 - 14532097
Alignment:
| Q |
10 |
gcagagatgttcccggcggttgctccttatccttcattccgaccgacttccattcgctactctaacgaccgacaggcgcttttcaaccgcattgctcctg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14532413 |
gcagagatgttcccggcggttgctccttatccttcataccgaccgacttccattcgctgctctaacgaccgacaggcgcttttcaaccgcattgctcctg |
14532314 |
T |
 |
| Q |
110 |
tctatgataacgtgcgcgcttcttttttctttatcttnnnnnnnnnnnnnnnnnnnagtcttctttctccttcacaccttttcattgttgcagctgaatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14532313 |
tctatgataacgtgcgcgcttcttttttctttatctttctctctctctctctct--agtcttctttctccttcacaccttttcattgttgcagctgaatg |
14532216 |
T |
 |
| Q |
210 |
atttgctgagcttgggtcagcaccggatttggaagcgaatggctgtttcttggactgagtacgtattttgcttcttcacttaatcatttccttctattct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14532215 |
atttgctgagcttgggtcagcaccggatttggaagcgaatggctgtttcttggactgagtacgtattttgcttcttcacttaatcatttccttctattct |
14532116 |
T |
 |
| Q |
310 |
aatgaaattaattaatttg |
328 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14532115 |
aatgaaattaattaatttg |
14532097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University