View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8528_high_8 (Length: 341)
Name: NF8528_high_8
Description: NF8528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8528_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 155 - 334
Target Start/End: Complemental strand, 28036194 - 28036011
Alignment:
| Q |
155 |
agctacttcgaccgtttgtgtctttgtgaaacactttgttaaggtgnnnnnnn---gggttatttggtgaatctagatactactcataatttgtttatga |
251 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28036194 |
agctatttcaaccgtttgtgtctttgtgaaacactttgttaaggtgttttttttctgggttatttgatgaatctagatactactcataatttgtttatga |
28036095 |
T |
 |
| Q |
252 |
agcatcacattatgnnnnnnnn-gttttgtttggtgaatcaagataatgcttataatgtgtacgcgaagcaccatgctatgatg |
334 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28036094 |
agcatcacattatgtttttttttgttttgtttggtgaatcaagataatgcttataatgtgtacgtgaagcaccatgctatgatg |
28036011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University