View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8528_low_15 (Length: 329)
Name: NF8528_low_15
Description: NF8528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8528_low_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 23 - 329
Target Start/End: Original strand, 33109717 - 33110030
Alignment:
| Q |
23 |
ctgctttaatgcggcccgacaaatggacggtgggattgaacccctcggattagtatgtccttgggccggataccgaattcagagtgttatccttcctttt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33109717 |
ctgctttaatgcggcccgacaaatggacggtgggattgaacccctcggattagtatgtccttgggccggataccgaattcagagtgttatccttcctttt |
33109816 |
T |
 |
| Q |
123 |
atgaaagcttaggcatc-------atacatcatgcattgctacccctcagcaaaatccagctagtgtacctgtcatttgatcatgatttttctcatacca |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33109817 |
atgaaagcttaggcatcattcatcatacatcatgcattgctacccctcagcaaaatccagctagtgtacctgtcatttgatcatgatttttctcatacca |
33109916 |
T |
 |
| Q |
216 |
tgctttctgaaaacaatatatcttctcccgtgtcttctcaaactcgaagtgatctttctgataataataataatttgatttcgcaagtcacgaatcatga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33109917 |
tgctttctgaaaacaatatatcttctcccgtgtcttctcaaactcgaagtgatctttctgataataataataatttgatttcgcaagtcacaaatcatga |
33110016 |
T |
 |
| Q |
316 |
taacatttacaaat |
329 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33110017 |
taacatttacaaat |
33110030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 98
Target Start/End: Original strand, 31206378 - 31206435
Alignment:
| Q |
41 |
acaaatggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
31206378 |
acaagtggacggtgggattggactcctcggattagtcggtccttgggccggataccga |
31206435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 4603917 - 4603969
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
4603917 |
tggacggtgggattggtcccctcggattagtcggtccttggatcggataccga |
4603969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 11064661 - 11064713
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||| ||||||||||| |||||| |||||| ||||||| ||| ||||||||| |
|
|
| T |
11064661 |
tggacagtgggattgaaaccctcgaattagtctgtccttaggctggataccga |
11064713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 23016760 - 23016712
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggata |
94 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| |||||| | ||||||| |
|
|
| T |
23016760 |
tggacggtgagattggacccctcggattagtaggtccttagaccggata |
23016712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 24286261 - 24286209
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||| ||||||||| |||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
24286261 |
tggacagtgggattggacccatcggattagtcagtccttaggccggataccga |
24286209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 24375961 - 24376013
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||| ||||||||| |||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
24375961 |
tggacagtgggattggacccatcggattagtcagtccttaggccggataccga |
24376013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 6427112 - 6427179
Alignment:
| Q |
30 |
aatgcggcccgacaaatggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
|||| ||||| |||| ||||| ||||||||||| ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
6427112 |
aatggggccccacaagtggacagtgggattgaatccctcggattagtcggtcctt-ggccggataccga |
6427179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 42281151 - 42281102
Alignment:
| Q |
49 |
acggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
|||||||| ||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
42281151 |
acggtggggttggacccctcggattagtctgtttttgggccggataccga |
42281102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 7250363 - 7250415
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
7250363 |
tggacagtgggattggacccctcggattagtccgtccttgggccagataccga |
7250415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 43963921 - 43963869
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
43963921 |
tggacggtgggattggacccctcagattagttggtccttgggctggataccga |
43963869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 43 - 101
Target Start/End: Original strand, 19174899 - 19174957
Alignment:
| Q |
43 |
aaatggacggtgggattgaacccctcggattagtatgtccttgggccggataccgaatt |
101 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
19174899 |
aaatgggcggtgggattgatcccctcggattaatcggtccttggatcggataccgaatt |
19174957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 98
Target Start/End: Original strand, 35943824 - 35943876
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
35943824 |
tggacggtgggattggacccctcggattagttggtcctcgggccaaataccga |
35943876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 26986138 - 26986090
Alignment:
| Q |
50 |
cggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||||||||||||||| |
|
|
| T |
26986138 |
cggtgggattggacccctcggaatagtcggtccttgggccggataccga |
26986090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 98
Target Start/End: Complemental strand, 39714712 - 39714655
Alignment:
| Q |
41 |
acaaatggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
|||| |||| |||||||||| || |||||||||||| |||||||||| ||||||||| |
|
|
| T |
39714712 |
acaagtggatggtgggattggactcctcggattagtcggtccttgggctggataccga |
39714655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 41 - 101
Target Start/End: Original strand, 37047127 - 37047187
Alignment:
| Q |
41 |
acaaatggacggtgggattgaacccctcggattagtatgtccttgggccggataccgaatt |
101 |
Q |
| |
|
|||| ||||||||||||||| |||||| |||||||| | ||||||||| |||||| |||| |
|
|
| T |
37047127 |
acaagtggacggtgggattggacccctaggattagtcggcccttgggcccgataccaaatt |
37047187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 99
Target Start/End: Original strand, 26158955 - 26159004
Alignment:
| Q |
50 |
cggtgggattgaacccctcggattagtatgtccttgggccggataccgaa |
99 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
26158955 |
cggtgggattgatcccctcggattagtcggtccttggatcggataccgaa |
26159004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 40302703 - 40302651
Alignment:
| Q |
46 |
tggacggtgggattgaacccctcggattagtatgtccttgggccggataccga |
98 |
Q |
| |
|
||||||||||||||| ||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
40302703 |
tggacggtgggattggacccctcaaattagtcggtccttgggctggataccga |
40302651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University