View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8528_low_19 (Length: 291)
Name: NF8528_low_19
Description: NF8528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8528_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 108 - 281
Target Start/End: Original strand, 7795482 - 7795655
Alignment:
| Q |
108 |
agagggaagagataaatcggaagacagaaaaacagaagtgttggactaccagcgcccaaacgaacacctggtttctcgtacactcgttattcccgaatga |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7795482 |
agagagaagagataaatcggaagacagaaaaacagaagtgttggactaccagcgcccaaacgaacacctggtttctcgtacactcgttattcccgaatga |
7795581 |
T |
 |
| Q |
208 |
cacaacacaatggagagacggtgacactgctttggctggatatggttgcagggactctctccctcttatctctg |
281 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
7795582 |
cacaacacaatggagagacggtgacgctggtttggctggctatggttgcagggactctctccatcttatctctg |
7795655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 45 - 91
Target Start/End: Original strand, 7795448 - 7795494
Alignment:
| Q |
45 |
tcttaattcttttttgtgcaatataaccacttacatagagaagagat |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7795448 |
tcttaattcttttttgtgcaatataaccacttacagagagaagagat |
7795494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 194 - 266
Target Start/End: Complemental strand, 7802607 - 7802535
Alignment:
| Q |
194 |
ttattcccgaatgacacaacacaatggagagacggtgacactgctttggctggatatggttgcagggactctc |
266 |
Q |
| |
|
|||||||| ||| | ||||||||||||||||| |||| | ||||||||||||| | |||||||||||| |||| |
|
|
| T |
7802607 |
ttattcccaaattatacaacacaatggagagatggtggcgctgctttggctggctgtggttgcagggaatctc |
7802535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 7794333 - 7794377
Alignment:
| Q |
1 |
agtactagaaagtttactgtcacattat-atgttggatgttttat |
44 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
7794333 |
agtactagaaagtttactatcacattataatgttggatgttttat |
7794377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University