View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8528_low_22 (Length: 207)
Name: NF8528_low_22
Description: NF8528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8528_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 2556268 - 2556440
Alignment:
| Q |
17 |
gaaggactcgatttaagcatcgttgaatcgttttcggcactgaatgagttcttaaaattggttaggtctcttttccactcaaactcaatgcagaatgaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556268 |
gaaggactcgatttaagcatcgttgaatcgtttccggcactgaatgagttcttaaaattggttaggtctcttttccactcaaactcaatgcagaatgaaa |
2556367 |
T |
|
| Q |
117 |
ctgaattgttatcagataaaagcaagtgagtttgaaaagcttcatttggttcatcaaggttttgcatatcact |
189 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||| |
|
|
| T |
2556368 |
ctaaattgttatcggataaaagcaagtgagtttgaaaagcttcattttgttcatcaaggttttgtagatcact |
2556440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 69 - 154
Target Start/End: Complemental strand, 30126574 - 30126489
Alignment:
| Q |
69 |
taaaattggttaggtctcttttccactcaaactcaatgcagaatgaaactgaattgttatcagataaaagcaagtgagtttgaaaa |
154 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30126574 |
taaaattggttatgcctcttttccactcaaactcaatggagaattaaactgaattgttatcagataagagcaagtgagtttgaaaa |
30126489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University