View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8529_low_5 (Length: 323)
Name: NF8529_low_5
Description: NF8529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8529_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 5184560 - 5184287
Alignment:
| Q |
18 |
acaattgtgtcagtcataatcagtggagttaggtatattctggaaaagtcatttagaatcgtcaatttatcattctggctagaaatattcattatatata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5184560 |
acaattgtgtcagtcataatcagtggagttaggtatattctgggaaagtcatttagaatcgtcaatttatcattctggctagaaatattcattatatata |
5184461 |
T |
 |
| Q |
118 |
gagaattatgtcttcattttaattgtctttgtttggctgtttgcattttcttcactcccaatatacatattttgccctgtctagacacttgtgttttaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5184460 |
gagaattatgtcttcattttaattgtctttgtttggctgtttgcattttcttcactcccaatatacatattttgccctgtctagacacttgtgttttaat |
5184361 |
T |
 |
| Q |
218 |
acataaatcaaataggtaacgtatgtatgtaggacatatcaaaattatagtaataaatgtttacttgtttcctt |
291 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5184360 |
acataaatcaaataggtaaagtatgtatgtagggcatatcaaaattatagtaacaaatgtttacttgtttcctt |
5184287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University