View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8530_low_20 (Length: 241)
Name: NF8530_low_20
Description: NF8530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8530_low_20 |
 | |
|
| [»] scaffold0174 (1 HSPs) |
| | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0174 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: scaffold0174
Description:
Target: scaffold0174; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 114 - 238
Target Start/End: Original strand, 32138 - 32262
Alignment:
| Q |
114 |
agccaatttatcacttttctgaaaaatccatcaacatttcctccctcttggtctccattgtgtccaccttcaactctttctaccccaaaatttgcttggg |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32138 |
agccaatttatcacttttcccaaaaatccatcaacatttcctccctcatggtctccattgtgtccaccttcaactctttctaccccaaaatttgcttggg |
32237 |
T |
|
| Q |
214 |
agttttcagtttcaccgactacaaa |
238 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
32238 |
agttttccgtttcaccgactacaaa |
32262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 138 - 241
Target Start/End: Original strand, 24895158 - 24895261
Alignment:
| Q |
138 |
aatccatcaacatttcctccctcttggtctccattgtgtccaccttcaactctttctaccccaaaatttgcttgggagttttcagtttcaccgactacaa |
237 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| | ||||||||||||||||||| || || |||||||||||||||||| ||||||| |
|
|
| T |
24895158 |
aatccatcaacatttcctccttcatggtctccattgtgtccatcctcaactctttctaccccaattttgtttttggagttttcagtttcaccaactacaa |
24895257 |
T |
|
| Q |
238 |
atca |
241 |
Q |
| |
|
|||| |
|
|
| T |
24895258 |
atca |
24895261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University