View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8530_low_5 (Length: 443)
Name: NF8530_low_5
Description: NF8530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8530_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 430; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 1 - 438
Target Start/End: Original strand, 44995619 - 44996056
Alignment:
| Q |
1 |
tggtgaccctgatcaggctatggctgtctttaaggatgggctaggaaaaggtttaaggccgagcattattgtttacaataccttgattaaagggttatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44995619 |
tggtgaccctgatcaggctatggctgtctttaaggatgggctaggaaaaggtttaaggccgagcattattgtttacaataccttgattaaagggttatgt |
44995718 |
T |
|
| Q |
101 |
cagcaaggtctgattttgccggctttgcaattgatgaatgagatgacagaaaagggttgtaaacctgatatatggacttataatttaattataaatggct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44995719 |
cagcaaggtctgattttgccggctttgcaattgatgaatgagatggcagaaaagggttgtaaacctgatatatggacttataatttaattataaatggcc |
44995818 |
T |
|
| Q |
201 |
tgtgcaagatgggttgtttatctgatgctaatcatcttattggtgatgctataaccaaaggatgcatcccagacatatttacatacaacactttggttga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44995819 |
tgtgcaagatgggttgtttatctgatgctaatcatcttattggtgatgctataaccaaaggatgcatcccagacatatttacatacaacactttggttga |
44995918 |
T |
|
| Q |
301 |
cggctattgcagacagttgaagttagacagtgcaattgagttggtaaacagaatgtggagtcaaggtatgactcctgatgttatcacatataacactttg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44995919 |
cggctattgcagacagttgaagttagacagtgcaattgagttggtaaacagaatgtggagtcaaggtatgactcctgatgttatcacatataacactttg |
44996018 |
T |
|
| Q |
401 |
ttgaatggactgtgcaaaactgcaaagtccgaagaagt |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44996019 |
ttgaatggactgtgcaaaactgcaaagtccgaagaagt |
44996056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University