View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8530_low_8 (Length: 379)
Name: NF8530_low_8
Description: NF8530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8530_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 16 - 83
Target Start/End: Complemental strand, 32425079 - 32425012
Alignment:
| Q |
16 |
gacatcatttagaatcaatagcaccaacatttctaatggaacgcgtgtcagtgtcccattgattatat |
83 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32425079 |
gacattatttagaatcaatagcaccaacatttctaatggaacgcgtgtcagtgtcccattgactatat |
32425012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 22 - 111
Target Start/End: Complemental strand, 1542918 - 1542828
Alignment:
| Q |
22 |
atttagaatcaatagcaccaacatttctaatggaacgcgtgtcagtgtcccat-tgattatattcaaatcacttattttcttaaattatta |
111 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| ||||| || || ||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
1542918 |
atttggaatcaatagcaccaacatttcaaatggaacgtgtgtcggtatcacatgtgattatattcaaataaattattttcttaaattatta |
1542828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University