View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8531_low_13 (Length: 260)
Name: NF8531_low_13
Description: NF8531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8531_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 4030887 - 4030665
Alignment:
| Q |
19 |
gctttctgtttcatgttttatttcatcttattatagactatactttctttaatatgaagcaatgtgtctcaacaagcttcacaatatcttttaaattgac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4030887 |
gctttctgtttcatgttttatttcatcttattatagactatactttctttaatatgaagcaatgtgtctcaacaagcttcacaatatcttttaaattgac |
4030788 |
T |
|
| Q |
119 |
ctggaccccactataattgtattcatactatttccctttgcttccactccacttatgtctcactatatatcagaagaaaatattgaactcaagagacgtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4030787 |
ctggaccccactataattgtattcatactatttccctttgcttccactccacttatgtctcactatatatcaggagaaaatattgaactcaagagacgtt |
4030688 |
T |
|
| Q |
219 |
aacataatctgctataacccttc |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4030687 |
aacataatctgctataacccttc |
4030665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University