View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8531_low_18 (Length: 234)
Name: NF8531_low_18
Description: NF8531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8531_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 29024451 - 29024665
Alignment:
| Q |
12 |
attattcttatagattaaaaattgatgtgagtctcaacttgcaatttagaatttatggataccttgatggataagatgcctcattgccttgttattgtta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29024451 |
attattcttatagattaaaaattgatgtgagtctcaacttgcaatttagaatttatggataccttgatggataagatgcctcattgccttgttattgtta |
29024550 |
T |
 |
| Q |
112 |
tacagttatatcattattcaatgtttgcaacgaagacagataagataagaacattgatgaatttatgataactaagaccactttgtctttaaggggttca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29024551 |
tacagttatatcattattcaatgtttgcaacgaagacagataagataagaacattgatgaatttatgataactaagaccactttgtctttaagtggttca |
29024650 |
T |
 |
| Q |
212 |
tattattttgatgtc |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29024651 |
tattattttgatgtc |
29024665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University